News list

Newsletter December 2024
Published on
04/02/2025
December 2024 Newsletter to the attention of the NRLs for VMPR of Antimicrobials and Dyes in food from animal origin
NEW METHODS ONLINE
Published on
04/02/2025
Method for the detection and confirmatory quantification of five nitrofuran metabolite residues in biological matrices using LC-MS/MS ANSES/LMV/19/01 - V5 of December 2024 And Method for the detection and quantification of residues of prohibited veterinary medicines in casings using LC-MS/MS F/CHIM/SM/PTC/036 - V1 of January 2025
TRACES 2025: second announcement and call for papers
Published on
04/02/2025
June 3-6, 2025 Residues of pharmacologically active substances in food, feed and environment, within the One Health concept TRACES 2025 - TRACES
Infographics on pullets' outdoor and litter access
Published on
03/02/2025
The EURCAW-Poultry-SFA is proud of presenting you its two latest infographics, issued respectively from two Q2E answers, realized in collaboration with La Chaire bien-être animal: Outdoor access for pullets (available in ENG and FR) Pullets access to litter for dustbathing (available in EN and FR) You can have access to the Q2E answers following the links below: Answer-Q2E-Poultry-SFA-2021-001  Answer_Q2E-Poultry-SFA-2022-008
Rabies diagnostic proficiency test for 2025: Registration Open!
Published on
29/01/2025
The EURL Team is pleased to launch a call for participation in a rabies diagnostic proficiency test that will be organized in 2025. Registration ends on February 3rd 2025. This proficency test is restricted to network members who received an invitation. It will be performed on a unique panel to evaluate the rabies diagnosis conclusion on 10 samples using at least one of the following techniques: FAT (Fluorescent Antibody Test), RTCIT (Rabies Tissue Culture Infection Test), Conventional RT-PCR and Real-Time RT-PCR according to the diagnosis scheme of the participating laboratory. The EURL Team would like to thank in advance all laboratories who will register.
Workshop for Rabies 2025 : Registration Open!
Published on
29/01/2025
The registration to the 16th workshop for rabies that will be held on 10 and 11 June 2025 in Maisons-Alfort is now open. This new Workshop edition will be held exclusively in person at ANSES headquarters. It will address the current situation of rabies surveillance and control in EU. More details like the provisional agenda will be soon relayed to registered participants. Registration to this event is restricted to National Reference Laboratories from the European Union Member States and to selected partners of the EURL network and can be done until February 17, 2025.   See you soon in Maisons-Alfort!
Launch of the SafeFood4ClimDiet Project
Published on
15/01/2025
The SafeFood4ClimDiet project, funded by the French National Research Agency (ANR) under the "Jeune Chercheur - Jeune Chercheuse (JCJC)" program, officially kicks off on January 15, 2025. This pioneering project investigates the effects of climate change on consumer eating habits and associated microbiological risks. Through interdisciplinary approaches, including sociological analysis, text-mining, and risk ranking, it aims to provide actionable recommendations to address current and future food safety challenges. The project emphasizes raising awareness among consumers and stakeholders about these critical issues. Stay tuned on our website for updates on SafeFood4ClimDiet!
rtRT-PCR for the detection of O/ME-SA/SA-2018 FMDV
Published on
14/01/2025
This real-time RT-PCR is a molecular tool for detection of Foot-and-mouth disease virus lineage O/ME-SA/SA-2018, as it is an emerging lineage in South Asia since 2018. The assay has been tested on 34 FMDV positive samples (including 12 SA-2018 samples) with a specificity of 91,7% (11/12 SA-2018 samples detected). The primers and probes are indicated hereafter:  Oligo name (final concentration) Sequence (5’-3’) Use SA2018_F3 (0.4 μM) ACAACACCACCAATCCAAC Forward Primer SA2018_P3 (0.3 μM) FAM-ACTCACCCGACTTGCACTGCCGT-TAMRA Probe  SA2018_Rev2 (0.4 μM) CGTTGTAAACAGTAGCCATGA Reverse Primer The SA-2018 has been validated using Ag-Path kit in a duplex system with β-actin, and following the volumes and concentrations as follow (5 µl of RNA):    Volume (µl)  Concentration    For one tube  Initial  Final  Ultrapure water (DNase RNase Free)  1,15  /  Buffer 2X (kit AgPath-ID™)  12,5  2  1  X  Primer F  1  10  0,4  µM  Primer R  1  10  0,4  µM  Probe FAM-TAMRA  0,75  10  0,3  µM  Primer F β-actine  1  10  0,4  µM  Primer R β-actine  1  10  0,4  µM  Probe VIC-TAMRA β-actine  0,6  5  0,12  µM  RT-PCR mix 25X (Enzyme)  1  25  1  X  Real-time PCR program:  Cycles of RTq-PCR  T°  Time  nb cycles  45°C  10min  1  95°C  10min  1  95°C  15s  45  62°C  1min     NB: This system has been validated on a small number of samples and should therefore be tested against other samples from this lineage.     
Outbreak of Foot-and-Mouth disease in Germany
Published on
10/01/2025
An outbreak of Foot-and-Mouth Disease has been reported in Germany in water buffaloes. The outbreak is located in the Brandenburg region, close to Berlin (first reports of this disease in Germany since 1988). This is the first case in the EU since 2011 in Bulgaria. According to the regional authorities, three water buffaloes are confirmed as infected. Restriction zones have been set up around the outbreak. The identification of the serotype is pending. For more information: https://wahis.woah.org/#/in-review/6177 ; https://www.fli.de/en/news/short-messages/short-message/fli-confirms-foot-and-mouth-disease-in-brandenburg-water-buffalo/
Newsletter December 2024
Published on
18/12/2024
December 2024 Newsletter to the attention of the NRLs for VMPR of Antimicrobials and Dyes in food from animal origin

Pages